Journal: Cancers

Article Title: Sorafenib Resistance Contributed by IL7 and MAL2 in Hepatocellular Carcinoma Can Be Overcome by Autophagy-Inducing Stapled Peptides

doi: 10.3390/cancers15215280

Figure Lengend Snippet: Top ten upregulated genes in PLC/PRF/5 Sor-R resistant cells.

Article Snippet: The Lenti ORF clone of human MAL2 , Myc-DDK-tagged (OriGene Technologies; RC203862L1) was also used as cDNA template of MAL2 for high fidelity PCR using primer pairs Kpn I-Kozak- MAL2 forward CAGGGTACCGCCACCATGTCGGCCGGCGGAGCGTC (5′ to 3′) and Eco RV- MAL2 reverse CGTACGATATCTTACGGTCG CCATCTTCGTA (5′ to 3′), then cloned into a PB transposon expression vector using a similar method for generating pPB/SB- IL7 -GFP-Puro.

Techniques:

Journal: Cancers

Article Title: Sorafenib Resistance Contributed by IL7 and MAL2 in Hepatocellular Carcinoma Can Be Overcome by Autophagy-Inducing Stapled Peptides

doi: 10.3390/cancers15215280

Figure Lengend Snippet: In vitro validation of the role of IL7 and MAL2 in HCC-associated Sorafenib drug resistance. ( A ) IL7 and MAL2 were significantly overexpressed in Sorafenib-resistant mutant PLC/PRF/5 cell pool (Sor-R) compared to the wild-type (WT) parental cell line by qPCR. ****, p < 0.0001; Student unpaired t -test. ( B ) Graphical representation showing significantly more colony forming ability by Sorafenib-resistant mutant PLC/PRF/5 (PLC5 Sor-R) cells when compared with wild-type (WT) parental PLC/PRF/5 (PLC5) cells under different Sorafenib concentrations (4 and 8 µM). ****, p < 0.0001; *, p < 0.05; two-way ANOVA test. ( C ) Overexpression of IL7 and/or MAL2 were confirmed in transfected PLC5 cells by qPCR compared with GFP control transfected cells. ****, p < 0.0001; Student unpaired t -test. Representative clonogenic survival assay images of PLC5 cells overexpressing IL7 and/or MAL2 under different Sorafenib concentrations. ( D ) Co-expression of IL7 and MAL2 in PLC5 cells treated with 10 µM Sorafenib induced greater anti-apoptotic effect compared with control GFP -overexpressing cells. Flow cytometry profiles represented intensity of Annexin-V-APC staining in X -axis and PI in Y -axis. ( E ) Graphical quantification of the apoptosis assay. ****, p < 0.0001; ***, p < 0.001; **, p < 0.01; two-way ANOVA test.

Article Snippet: The Lenti ORF clone of human MAL2 , Myc-DDK-tagged (OriGene Technologies; RC203862L1) was also used as cDNA template of MAL2 for high fidelity PCR using primer pairs Kpn I-Kozak- MAL2 forward CAGGGTACCGCCACCATGTCGGCCGGCGGAGCGTC (5′ to 3′) and Eco RV- MAL2 reverse CGTACGATATCTTACGGTCG CCATCTTCGTA (5′ to 3′), then cloned into a PB transposon expression vector using a similar method for generating pPB/SB- IL7 -GFP-Puro.

Techniques: In Vitro, Mutagenesis, Over Expression, Transfection, Control, Clonogenic Cell Survival Assay, Expressing, Flow Cytometry, Staining, Apoptosis Assay

Journal: Cancers

Article Title: Sorafenib Resistance Contributed by IL7 and MAL2 in Hepatocellular Carcinoma Can Be Overcome by Autophagy-Inducing Stapled Peptides

doi: 10.3390/cancers15215280

Figure Lengend Snippet: Activation of JAK/STAT and PI3K/AKT signaling pathways by IL7 and MAL2 in HCC-associated Sorafenib resistance. ( A ) Representative Western blot and relative protein level analyses confirming STAT3 activation in IL7 and MAL2 overexpressing PLC/PRF/5 cells compared with GFP control PLC/PRF/5 cells. *, p < 0.05; **, p < 0.01; two-way ANOVA test. ( B ) Representative Western blot and relative protein level analyses confirming PI3K/AKT activation in IL7 and MAL2 overexpressing PLC/PRF/5 cells compared with GFP control PLC/PRF/5 cells. *, p < 0.05; **, p < 0.01; two-way ANOVA test. ( C ) CDKN1A expression was significantly induced in IL7 and/or MAL2 overexpressing PLC/PRF/5 cells under Sorafenib treatment. **, p < 0.01; ***, p < 0.001; Student unpaired t -test. ( D ) Representative Western blot and relative protein level analyses showing reduced phosphorylated JNK (p-JNK) levels in IL7 and MAL2 overexpressing PLC/PRF/5 cells compared with GFP control cells under Sorafenib treatment in a dose dependent manner. ( E ) Summary diagram showing MAL2, a transmembrane protein, contributes to intracellular trafficking and secretion of IL7 to the plasma membrane. The binding of IL7 to cytokine receptors result in the activation of important downstream survival signaling pathways that contributes to Sorafenib resistance. The uncropped bolts are shown in .

Article Snippet: The Lenti ORF clone of human MAL2 , Myc-DDK-tagged (OriGene Technologies; RC203862L1) was also used as cDNA template of MAL2 for high fidelity PCR using primer pairs Kpn I-Kozak- MAL2 forward CAGGGTACCGCCACCATGTCGGCCGGCGGAGCGTC (5′ to 3′) and Eco RV- MAL2 reverse CGTACGATATCTTACGGTCG CCATCTTCGTA (5′ to 3′), then cloned into a PB transposon expression vector using a similar method for generating pPB/SB- IL7 -GFP-Puro.

Techniques: Activation Assay, Western Blot, Control, Expressing, Membrane, Binding Assay

Journal: Cancers

Article Title: Sorafenib Resistance Contributed by IL7 and MAL2 in Hepatocellular Carcinoma Can Be Overcome by Autophagy-Inducing Stapled Peptides

doi: 10.3390/cancers15215280

Figure Lengend Snippet: Autophagy-inducing stapled peptides exerted a synergistic anti-proliferative effect with Sorafenib in resistant HCC cells that co-overexpress both IL7 and MAL2. ( A ) Autophagy markers p62 and LC3-II were measured by Western blot in IL7 and MAL2-overexpressing PLC/PRF/5 cells compared with GFP control PLC/PRF/5 cells after treatment with or without the autophagy inducer rapamycin (500 nM, 3 h). ( B ) Statistic analysis of LC3-II and p62 level change of ( A ) after normalization to the level of β-Actin. ( C ) The two autophagy markers were assessed using Western blot in GFP control PLC/PRF/5 cells after treatment with Tat-SP9 (0, 10, 20 μM for 12 h) and Tat-SP4 (0, 10, 20 μM for 3 h) with or without 1 μM CQ. ( D ) Statistic analysis of LC3-II and p62 level change of ( C ) after normalization to the level of β-Actin. ( E ) Similar Western blots as ( C ), but cells are IL7 and MAL2-overexpressing PLC/PRF/5 cells. ( F ) Statistic analysis of LC3-II and p62 level change of ( E ) after normalization to the level of β-Actin. Bar represents mean ± SEM of three replicates. ( G ) Cell viability was assessed in IL7 and MAL2 -overexpressing PLC/PRF/5 cells and GFP control PLC/PRF/5 cells after treatment with different concentrations of Tat-SP9 and Tat-SP4. The estimated IC 50 value for Tat-SP9 was 12.63 μM in GFP control PLC/PRF/5 cells and 12.58 μM in Sorafenib-resistant cells, while the estimated IC 50 value for Tat-SP4 was 69.71 μM in control cells and 69.89 μM in resistant cells. ( H ) Clonogenic survival assay images were taken for both GFP control PLC/PRF/5 GFP cells and IL7 and MAL2-overexpressing PLC/PRF/5 cells under different concentrations of Tat-SP9 (10, 15, 20 μM). Bars represent mean ± SEM (n = 3). ( I ) Representative clonogenic survival assay images of GFP control PLC/PRF/5 cells and Sorafenib-resistant PLC/PRF/5 cells after treatment with Tat-SP9 (10 μM) or Sorafenib (2 or 4 μM), alone or combined. Bars represent mean ± SEM of three replicates. NS means no significant difference *, p < 0.05; **, p < 0.01; ***, p < 0.001,****, p < 0.0001 two-way ANOVA test. The uncropped bolts are shown in .

Article Snippet: The Lenti ORF clone of human MAL2 , Myc-DDK-tagged (OriGene Technologies; RC203862L1) was also used as cDNA template of MAL2 for high fidelity PCR using primer pairs Kpn I-Kozak- MAL2 forward CAGGGTACCGCCACCATGTCGGCCGGCGGAGCGTC (5′ to 3′) and Eco RV- MAL2 reverse CGTACGATATCTTACGGTCG CCATCTTCGTA (5′ to 3′), then cloned into a PB transposon expression vector using a similar method for generating pPB/SB- IL7 -GFP-Puro.

Techniques: Western Blot, Control, Clonogenic Cell Survival Assay